Mature sequence mmu-miR-432

Accession numberMIMAT0012771
IDmmu-miR-432
Stem-Loop mmu-mir-432
Sequence
ucuuggaguagaucagugggcag
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).