Mature sequence mmu-miR-767

Accession numberMIMAT0012773
IDmmu-miR-767
Stem-Loop mmu-mir-767
Sequence
ugcaccaugguugucugagca
Get sequence
Deep sequencing8 reads, 5 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).