Mature sequence ptr-miR-299

Accession numberMIMAT0012801
IDptr-miR-299
Stem-Loop ptr-mir-299
Sequence
ugguuuaccgucccacauacau
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).