Mature sequence rno-miR-615

Accession numberMIMAT0012835
IDrno-miR-615
Stem-Loop rno-mir-615
Sequence
ggggguccccggugcucggauc
Get sequence
Deep sequencing921 reads, 204 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).