Mature sequence rno-miR-875

Accession numberMIMAT0012842
IDrno-miR-875
Stem-Loop rno-mir-875
Sequence
uauaccucaguuuuaucaggug
Get sequence
Deep sequencing13 reads, 11 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).