Mature sequence rno-miR-711

Accession numberMIMAT0012859
IDrno-miR-711
Stem-Loop rno-mir-711
Sequence
gggacccugggagagauguaag
Get sequence
Deep sequencing2 reads, 2 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).