Mature sequence eca-let-7e

Accession numberMIMAT0013007
IDeca-let-7e
Stem-Loop eca-let-7e
Sequence
ugagguaggagguuguauaguu
Get sequence
Deep sequencing128738 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).