Mature sequence eca-miR-1301

Accession numberMIMAT0013070
IDeca-miR-1301
Stem-Loop eca-mir-1301
Sequence
uugcagcugccugggagugauuuc
Get sequence
Deep sequencing31 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).