Mature sequence eca-miR-155

Accession numberMIMAT0013182
IDeca-miR-155
Stem-Loop eca-mir-155
Sequence
uuaaugcuaaucgugauaggggu
Get sequence
Deep sequencing3355 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).