Mature sequence mtr-miR2592d-3p

Accession numberMIMAT0013270
IDmtr-miR2592d-3p
Previous IDsmtr-miR2592d
Stem-Loop mtr-MIR2592d
Sequence
aaaugcuugaguccuguuguu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
2
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).