Mature sequence cte-miR-2705

Accession numberMIMAT0013571
IDcte-miR-2705
Stem-Loop cte-mir-2705
Sequence
ucugcaagguaaagugcugucca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19755470 "MicroRNAs resolve an apparent conflict between annelid systematics and their fossil record" Sperling EA, Vinther J, Moy VN, Wheeler BM, Semon M, Briggs DE, Peterson KJ Proc Biol Sci. 276:4315-4322(2009).