Mature sequence ssc-miR-532-5p

Accession numberMIMAT0013940
IDssc-miR-532-5p
Stem-Loop ssc-mir-532
Sequence
caugccuugaguguaggaccgu
Get sequence
Deep sequencing2004 reads, 15 experiments

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).