Mature sequence bhv1-miR-B5

Accession numberMIMAT0013966
IDbhv1-miR-B5
Stem-Loop bhv1-mir-B5
Sequence
cucggagggcucggaggacgacuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19793906 "Characterization of microRNAs encoded by the bovine herpesvirus 1 genome" Glazov EA, Horwood PF, Assavalapsakul W, Kongsuwan K, Mitchell RW, Mitter N, Mahony TJ J Gen Virol. 91:32-41(2010).