Mature sequence zma-miR396h

Accession numberMIMAT0014017
IDzma-miR396h
Stem-Loop zma-MIR396h
Sequence
ucccacagcuuuauugaacug
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).