Mature sequence osa-miR2918

Accession numberMIMAT0014049
IDosa-miR2918
Stem-Loop osa-MIR2918
Sequence
auccguguugucugcgcuuua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20131478 "Cloning and validation of novel miRNA from basmati rice indicates cross talk between abiotic and biotic stresses" Sanan-Mishra N, Kumar V, Sopory SK, Mukherjee SK Mol Genet Genomics. 282:463-474(2009).