Mature sequence aae-miR-12-3p

Accession numberMIMAT0014254
IDaae-miR-12-3p
Previous IDsaae-miR-12*
Stem-Loop aae-mir-12
Sequence
caguacuuauguuaugcucucu
Get sequence
Deep sequencing85 reads, 2 experiments

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).