Mature sequence aae-miR-2c

Accession numberMIMAT0014308
IDaae-miR-2c
Stem-Loop aae-mir-2c
Sequence
uaucacagccagcuuugaugagc
Get sequence
Deep sequencing51848 reads, 2 experiments

References

1