Mature sequence aae-miR-9a

Accession numberMIMAT0014323
IDaae-miR-9a
Stem-Loop aae-mir-9a-1 aae-mir-9a-2
Sequence
ucuuugguuaucuagcuguauga
Get sequence
Deep sequencing50990 reads, 2 experiments

References

1