Mature sequence aae-miR-9b

Accession numberMIMAT0014324
IDaae-miR-9b
Stem-Loop aae-mir-9b
Sequence
ucuuuggugauuuuagcuguaugc
Get sequence
Deep sequencing1025 reads, 2 experiments

References

1