Mature sequence hsv2-miR-H9-3p

Accession numberMIMAT0014352
IDhsv2-miR-H9-3p
Stem-Loop hsv2-mir-H9
Sequence
uucccaccucggucuccuccuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19889786 "Identification of viral microRNAs expressed in human sacral ganglia latently infected with herpes simplex virus 2" Umbach JL, Wang K, Tang S, Krause PR, Mont EK, Cohen JI, Cullen BR J Virol. 84:1189-1192(2010).
2
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).