Mature sequence tgu-miR-148b

Accession numberMIMAT0014455
IDtgu-miR-148b
Stem-Loop tgu-mir-148b
Sequence
ucggagugucacagaacuuugc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).