Mature sequence hsv2-miR-H23-3p

• Accession number: MIMAT0014706
• ID: hsv2-miR-H23-3p
• Previous IDs: hsv2-miR-H23*
• Stem-Loop: hsv2-mir-H23
• Sequence: acgagcuucgcgguacuacuc
• Deep sequencing: reads, experiments

References

1. PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).