Mature sequence hsv2-miR-H23-3p

Accession numberMIMAT0014706
IDhsv2-miR-H23-3p
Previous IDshsv2-miR-H23*
Stem-Loop hsv2-mir-H23
Sequence
acgagcuucgcgguacuacuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).