Mature sequence hsa-miR-3185

Accession numberMIMAT0015065
IDhsa-miR-3185
Stem-Loop hsa-mir-3185
Sequence
agaagaaggcggucggucugcgg
Get sequence
Deep sequencing31 reads, 16 experiments
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).