Mature sequence zma-miR169p-3p

Accession numberMIMAT0015327
IDzma-miR169p-3p
Previous IDszma-miR169p*
Stem-Loop zma-MIR169p
Sequence
ggcaagucaucuggggcuacg
Get sequence
Deep sequencing10 reads, 5 experiments

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).