Mature sequence bmo-miR-3382-3p

Accession numberMIMAT0015576
IDbmo-miR-3382-3p
Previous IDsbmo-miR-3382*
Stem-Loop bmo-mir-3382
Sequence
ugccuccggacuggauucuugaacc
Get sequence
Deep sequencing12 reads, 2 experiments

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).