Mature sequence mmu-miR-3472

Accession numberMIMAT0015643
IDmmu-miR-3472
Stem-Loop mmu-mir-3472
Sequence
uaauagccagaagcuggaaggaacc
Get sequence
Deep sequencing684 reads, 45 experiments
Predicted targets

References

1
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).