Mature sequence nvi-let-7

Accession numberMIMAT0015678
IDnvi-let-7
Stem-Loop nvi-let-7
Sequence
ugagguaguagguuguauagu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).