Mature sequence ppy-miR-200a

Accession numberMIMAT0015796
IDppy-miR-200a
Stem-Loop ppy-mir-200a
Sequence
uaacacugucugguaacgaugu
Get sequence
Deep sequencing reads, experiments

References

1