Mature sequence ppy-miR-300

Accession numberMIMAT0015815
IDppy-miR-300
Stem-Loop ppy-mir-300
Sequence
uauacaagggcagacucucucu
Get sequence
Deep sequencing reads, experiments

References

1