Mature sequence ppy-miR-376a

Accession numberMIMAT0015864
IDppy-miR-376a
Stem-Loop ppy-mir-376a-1 ppy-mir-376a-2
Sequence
aucauagaggaaaauccacgu
Get sequence
Deep sequencing reads, experiments

References

1