Mature sequence ppy-miR-376c

Accession numberMIMAT0015866
IDppy-miR-376c
Stem-Loop ppy-mir-376c
Sequence
aacauagaggaaauuccacgu
Get sequence
Deep sequencing reads, experiments

References

1