Mature sequence ppy-miR-425

Accession numberMIMAT0015885
IDppy-miR-425
Stem-Loop ppy-mir-425
Sequence
aaugacacgaucacucccguuga
Get sequence
Deep sequencing reads, experiments

References

1