Mature sequence ppy-miR-490-5p

Accession numberMIMAT0015909
IDppy-miR-490-5p
Stem-Loop ppy-mir-490
Sequence
ccauggaucuccaggugggu
Get sequence
Deep sequencing reads, experiments

References

1