Mature sequence ppy-miR-490-3p

Accession numberMIMAT0015910
IDppy-miR-490-3p
Stem-Loop ppy-mir-490
Sequence
caaccuggaggacuccaugcug
Get sequence
Deep sequencing reads, experiments

References

1