Mature sequence ppy-miR-539

Accession numberMIMAT0015989
IDppy-miR-539
Stem-Loop ppy-mir-539
Sequence
ggagaaauuauccuuggugugu
Get sequence
Deep sequencing reads, experiments

References

1