Mature sequence ppy-miR-631

Accession numberMIMAT0016070
IDppy-miR-631
Stem-Loop ppy-mir-631
Sequence
agaccuggcccagaccucagc
Get sequence
Deep sequencing reads, experiments

References

1