Mature sequence ppy-miR-654-3p

Accession numberMIMAT0016088
IDppy-miR-654-3p
Stem-Loop ppy-mir-654
Sequence
uaugucugcugaccaucaccuu
Get sequence
Deep sequencing reads, experiments

References

1