Mature sequence ppy-miR-658

Accession numberMIMAT0016091
IDppy-miR-658
Stem-Loop ppy-mir-658
Sequence
ggcggagggaaguagguccguuggu
Get sequence
Deep sequencing reads, experiments

References

1