Mature sequence ppy-miR-668

Accession numberMIMAT0016095
IDppy-miR-668
Stem-Loop ppy-mir-668
Sequence
ugucacucggcucggcccacuac
Get sequence
Deep sequencing reads, experiments

References

1