Mature sequence ppy-miR-889

Accession numberMIMAT0016124
IDppy-miR-889
Stem-Loop ppy-mir-889
Sequence
uuaauaucggacaaccauugu
Get sequence
Deep sequencing reads, experiments

References

1