Mature sequence ppy-miR-1283b

Accession numberMIMAT0016205
IDppy-miR-1283b
Stem-Loop ppy-mir-1283b
Sequence
ucugcaaagggaagcccuuucu
Get sequence
Deep sequencing reads, experiments

References

1