Mature sequence cin-miR-92d-3p

Accession numberMIMAT0016424
IDcin-miR-92d-3p
Stem-Loop cin-mir-92d
Sequence
uauugcaccugucccggccg
Get sequence
Deep sequencing29 reads, 2 experiments

References

1