Mature sequence cin-miR-4005b-5p

Accession numberMIMAT0016467
IDcin-miR-4005b-5p
Stem-Loop cin-mir-4005b
Sequence
ugaguuggugcuaucaugcu
Get sequence
Deep sequencing175 reads, 2 experiments

References

1