Mature sequence cin-miR-4005b-3p

Accession numberMIMAT0016468
IDcin-miR-4005b-3p
Stem-Loop cin-mir-4005b
Sequence
caaggggaaguaccagcucu
Get sequence
Deep sequencing reads, experiments

References

1