Mature sequence cin-miR-4009a-5p

Accession numberMIMAT0016501
IDcin-miR-4009a-5p
Stem-Loop cin-mir-4009a
Sequence
gguuuuccauguguaagagc
Get sequence
Deep sequencing196 reads, 2 experiments

References

1