Mature sequence cin-miR-4009c-3p

Accession numberMIMAT0016505
IDcin-miR-4009c-3p
Stem-Loop cin-mir-4009c
Sequence
uauugcacuuuuacuguacc
Get sequence
Deep sequencing16 reads, 2 experiments

References

1