Mature sequence cin-miR-4077d-5p

Accession numberMIMAT0016689
IDcin-miR-4077d-5p
Stem-Loop cin-mir-4077d
Sequence
aaguuggcugugauuuggcu
Get sequence
Deep sequencing90 reads, 2 experiments

References

1