Mature sequence rno-miR-34b-3p

Accession numberMIMAT0017105
IDrno-miR-34b-3p
Previous IDsrno-miR-34b*
Stem-Loop rno-mir-34b
Sequence
aaucacuaacuccacugccauc
Get sequence
Deep sequencing10383 reads, 340 experiments
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).