Mature sequence rno-miR-192-3p

Accession numberMIMAT0017147
IDrno-miR-192-3p
Previous IDsrno-miR-192*
Stem-Loop rno-mir-192
Sequence
cugccaguuccauaggucacag
Get sequence
Deep sequencing10969 reads, 320 experiments
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).