Mature sequence rno-miR-200c-5p

Accession numberMIMAT0017150
IDrno-miR-200c-5p
Previous IDsrno-miR-200c*
Stem-Loop rno-mir-200c
Sequence
cgucuuacccagcaguguuug
Get sequence
Deep sequencing526 reads, 142 experiments
Predicted targets

References

1
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).